algorithms nis elements ar software nikon version 4 30 02 image lab software bio rad version 6 1 0 other nikon eclipse ti (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
algorithms nis elements ar software nikon version 4 30 02 image lab software bio rad version 6 1 0 other nikon eclipse ti
Algorithms Nis Elements Ar Software Nikon Version 4 30 02 Image Lab Software Bio Rad Version 6 1 0 Other Nikon Eclipse Ti, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 35689 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/elements+software/Image+Lab+Software/pm42867999-77-55-65
Average 99 stars, based on 35689 article reviews
Algorithms Nis Elements Ar Software Nikon Version 4 30 02 Image Lab Software Bio Rad Version 6 1 0 Other Nikon Eclipse Ti, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 35689 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/elements+software/Image+Lab+Software/pm42867999-77-55-65
Average 99 stars, based on 35689 article reviews
algorithms nis elements ar software nikon version 4 30 02 image lab software bio rad version 6 1 0 other nikon eclipse ti - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Cloning:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Quantitative RT-PCR:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Recombinant:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Article Title: In vivo characterization of emerging SARS-CoV-2 variant infectivity and human antibody escape potential Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human IgG-PE secondary antibody Invitrogen Catalog # 62-8420; RRID: AB_2533962 HRP-conjugated anti-human IgG, IgM, IgA (H+L) Invitrogen Catalog # A18847; RRID: AB_2535624 Anti-INFAR-1 (MAR1-5A3) Bio X Cell Catalog # BE0241; RRID: AB_2687723 Anti-RBD primary antibody Sino Biological Catalog # 40592-T62 HRP-conjugated goat anti-rabbit IgG secondary antibody Invitrogen Catalog # 31402 RRID: AB_228395 Anti-His secondary antibody BioLegend Catalog # 652502; RRID: AB_2556553 Anti-VSV-G ATCC Catalog # CRL-2700 Bacterial and virus strains rVSV-dG/G* luciferase Kerafast Catalog # EH1020-PM rVSV-dG/G* GFP Kerafast Catalog # EH1019-PM Recombinant adenoviral vectors expressing human ACE2 (AdV-hACE2) University of Iowa Viral Vector Core Ad5CMVhACE2; VVC-McCray-7723 WT (no 19del), WT, D614G, N501Y (no 19del), N501Y, N501Y + D614G, N501Y + L452R + D614G, or N501Y + K417N +E484K + D614G, N501Y + D614G + K417N + L452R +E484K, N501Y + D614G + K417N + L452R + E484Q PsVs This Paper N/A Biological samples COVID 19+ human plasma Stem Cells Lot# 2008421004; 2009418006; 2006417008; 2009418001 COVID 19+ human plasma RayBiotech PS362; PS364 COVID 19+ human plasma This Paper N/A Vaccinated human plasma This Paper N/A Control human plasma Pennsylvania Plasma N/A Chemicals, peptides, and recombinant proteins RBD-Fc This paper N/A RBD-His This paper N/A N501Y-RBD-His Sino Biological Catalog# 40592-V08H82 N501Y-RBD-Fc This paper N/A MPL Sigma Aldrich SAB1406140 D-luciferin GoldBio Catalog # eLUCNA-100; CAS # 103404-75-7 Hoechst 33342 Invitrogen Catalog # H3570 Prolong Glass Invitrogen Catalog # P36980 Zombie Aqua Viability Dye BioLegend Catalog # 423101 Human TruStain FcX BioLegend Catalog # 422301 Critical commercial assays Expi293F expression system kit Thermo Fisher Scientific Catalog # A14635 4-15% Tris-glycine SDS-PAGE gels Bio-Rad Catalog # 4568033 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Catalog # A53225 Luciferase assay kit Promega Catalog # E1500 Lipofectamine 3000 Thermo Fisher Scientific Catalog # L3000001 (Continued on next page) e1 Cell Reports 37, 109838, October 19, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RBD in complex with mouse ACE2 Brooke and Prischi, 2020 https://github.com/fprischi/ Supplementary_ComplexesStructures Experimental models: Cell lines 293 TT cells ATCC CRL-3467 BHK-21 cells ATCC CCL-10 Experimental models: Organisms/strains BALB/c Charles River Strain code: 028 BALB/cAnNCrl C57BL/6 Taconic Model: B6-F C57BL/6NTac Oligonucleotides Primers for generating SARS-CoV2 spike sequence or mutant PsV plasmid, see Table S1 Integrated DNA Technologies N/A Recombinant DNA pCMV3-SARS-CoV-2-S Sino Biological Inc. Beijing, China Catalog # VG40592-UT pFuse-mIgG2a-Fc2 Invivogen pfuse-mg2afc2 pCMV3-SARS-CoV-2-S-N501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19 This paper N/A pCMV3-SARS-CoV-2-S-N501Y-cd19 This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614G This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-E484K This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-L452R-E484Q This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-L452R This paper N/A pfuse-RBD-mIgG2aFc This paper N/A pfuse-RBD-N501Y-mIgG2aFc This paper N/A Software and algorithms CytExpert Beckman Coulter https://www.beckman.com/ flow-cytometry/instruments/cytoflex/ software Gen5 Biotek Instruments https://www.biotek.com/products/ software-robotics-software/gen5microplate-reader-and-imager-software/ Living Image Xenogen https://www.perkinelmer.com/product/ spectrum-200-living-image-v4series1-128113 NIS-Elements Nikon https://www.microscope.healthcare.nikon. Generated:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Software:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Article Title: In vivo characterization of emerging SARS-CoV-2 variant infectivity and human antibody escape potential Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human IgG-PE secondary antibody Invitrogen Catalog # 62-8420; RRID: AB_2533962 HRP-conjugated anti-human IgG, IgM, IgA (H+L) Invitrogen Catalog # A18847; RRID: AB_2535624 Anti-INFAR-1 (MAR1-5A3) Bio X Cell Catalog # BE0241; RRID: AB_2687723 Anti-RBD primary antibody Sino Biological Catalog # 40592-T62 HRP-conjugated goat anti-rabbit IgG secondary antibody Invitrogen Catalog # 31402 RRID: AB_228395 Anti-His secondary antibody BioLegend Catalog # 652502; RRID: AB_2556553 Anti-VSV-G ATCC Catalog # CRL-2700 Bacterial and virus strains rVSV-dG/G* luciferase Kerafast Catalog # EH1020-PM rVSV-dG/G* GFP Kerafast Catalog # EH1019-PM Recombinant adenoviral vectors expressing human ACE2 (AdV-hACE2) University of Iowa Viral Vector Core Ad5CMVhACE2; VVC-McCray-7723 WT (no 19del), WT, D614G, N501Y (no 19del), N501Y, N501Y + D614G, N501Y + L452R + D614G, or N501Y + K417N +E484K + D614G, N501Y + D614G + K417N + L452R +E484K, N501Y + D614G + K417N + L452R + E484Q PsVs This Paper N/A Biological samples COVID 19+ human plasma Stem Cells Lot# 2008421004; 2009418006; 2006417008; 2009418001 COVID 19+ human plasma RayBiotech PS362; PS364 COVID 19+ human plasma This Paper N/A Vaccinated human plasma This Paper N/A Control human plasma Pennsylvania Plasma N/A Chemicals, peptides, and recombinant proteins RBD-Fc This paper N/A RBD-His This paper N/A N501Y-RBD-His Sino Biological Catalog# 40592-V08H82 N501Y-RBD-Fc This paper N/A MPL Sigma Aldrich SAB1406140 D-luciferin GoldBio Catalog # eLUCNA-100; CAS # 103404-75-7 Hoechst 33342 Invitrogen Catalog # H3570 Prolong Glass Invitrogen Catalog # P36980 Zombie Aqua Viability Dye BioLegend Catalog # 423101 Human TruStain FcX BioLegend Catalog # 422301 Critical commercial assays Expi293F expression system kit Thermo Fisher Scientific Catalog # A14635 4-15% Tris-glycine SDS-PAGE gels Bio-Rad Catalog # 4568033 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Catalog # A53225 Luciferase assay kit Promega Catalog # E1500 Lipofectamine 3000 Thermo Fisher Scientific Catalog # L3000001 (Continued on next page) e1 Cell Reports 37, 109838, October 19, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RBD in complex with mouse ACE2 Brooke and Prischi, 2020 https://github.com/fprischi/ Supplementary_ComplexesStructures Experimental models: Cell lines 293 TT cells ATCC CRL-3467 BHK-21 cells ATCC CCL-10 Experimental models: Organisms/strains BALB/c Charles River Strain code: 028 BALB/cAnNCrl C57BL/6 Taconic Model: B6-F C57BL/6NTac Oligonucleotides Primers for generating SARS-CoV2 spike sequence or mutant PsV plasmid, see Table S1 Integrated DNA Technologies N/A Recombinant DNA pCMV3-SARS-CoV-2-S Sino Biological Inc. Beijing, China Catalog # VG40592-UT pFuse-mIgG2a-Fc2 Invivogen pfuse-mg2afc2 pCMV3-SARS-CoV-2-S-N501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19 This paper N/A pCMV3-SARS-CoV-2-S-N501Y-cd19 This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614G This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-E484K This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-L452R-E484Q This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-L452R This paper N/A pfuse-RBD-mIgG2aFc This paper N/A pfuse-RBD-N501Y-mIgG2aFc This paper N/A Software and algorithms CytExpert Beckman Coulter https://www.beckman.com/ flow-cytometry/instruments/cytoflex/ software Gen5 Biotek Instruments https://www.biotek.com/products/ software-robotics-software/gen5microplate-reader-and-imager-software/ Living Image Xenogen https://www.perkinelmer.com/product/ spectrum-200-living-image-v4series1-128113 NIS-Elements Nikon https://www.microscope.healthcare.nikon. Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Article Title: POLE Mutation Spectra Are Shaped by the Mutant Allele Identity, Its Abundance, and Mismatch Repair Status. Article Snippet: Article Article Title: Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RAD52 Santa Cruz Cat# sc-8350; RRID:AB_2284949 RAD51 Santa Cruz Cat# sc-8349; RRID:AB_2253533 POLD3 Bethyl Cat# A301-244A; RRID:AB_890596 POLD4 Novus Biologicals Cat# H00057804-M01A; RRID:AB_2166594 BLM Bethyl Cat# A300-110A; RRID:AB_2064794 GAPDH Millipore Cat# ABS16; RRID:AB_10806772 PML Abcam Cat# ab96051; RRID:AB_10679887 Biotin Abcam Cat# ab53494; RRID:AB_867860 Chemicals, and Recombinant Proteins T4 polynucleotide Kinase NEB M0201S Proteinase K Thermo Fischer 25530049 Thymidine Sigma T1895-5G CDKi (RO-3306) Selleckchem S7747 .. ATP gamma P32 Perkin Elmer NEG002250uc IPTG Calbiochem 420322 Ni2+-NTA beads QIAGEN 30230 Affi-Gel Blue Gel BioRad 1537301 Click-iT EdU Alexa Fluor 488 Imaging Kit Thermo Fischer C10337 TelC-FITC PNA Bio F1009 Dextran Sulfate sodium Sigma D8906-10G Formamide Sigma 47671-1L-F 20x SSC Thermo Fischer AM9763 Azide-PEG3-Biotin Sigma 762024-10MG phi29 DNA Polymerase NEB M0269L dNTP Set(100 mM) Thermo Fischer 10297018 PureLink Genomic DNA Mini Kit Thermo Fischer K182002 Sequence-Based Reagents siRNA This Study See Table S1 Primers for C circle This Study See Table S2 Oligos for in vitro substrates preparation This study See Table S3 Software and Article Title: Bone marrow-derived mesenchymal stem cells transplantation ameliorates renal injury through anti-fibrotic and anti-inflammatory effects in chronic experimental renovascular disease Article Snippet: .. Immunoreactive bands densitometry was performed by Adobe Photoshop Elements 9 software on images obtained by Sequencing:Article Title: In vivo characterization of emerging SARS-CoV-2 variant infectivity and human antibody escape potential Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human IgG-PE secondary antibody Invitrogen Catalog # 62-8420; RRID: AB_2533962 HRP-conjugated anti-human IgG, IgM, IgA (H+L) Invitrogen Catalog # A18847; RRID: AB_2535624 Anti-INFAR-1 (MAR1-5A3) Bio X Cell Catalog # BE0241; RRID: AB_2687723 Anti-RBD primary antibody Sino Biological Catalog # 40592-T62 HRP-conjugated goat anti-rabbit IgG secondary antibody Invitrogen Catalog # 31402 RRID: AB_228395 Anti-His secondary antibody BioLegend Catalog # 652502; RRID: AB_2556553 Anti-VSV-G ATCC Catalog # CRL-2700 Bacterial and virus strains rVSV-dG/G* luciferase Kerafast Catalog # EH1020-PM rVSV-dG/G* GFP Kerafast Catalog # EH1019-PM Recombinant adenoviral vectors expressing human ACE2 (AdV-hACE2) University of Iowa Viral Vector Core Ad5CMVhACE2; VVC-McCray-7723 WT (no 19del), WT, D614G, N501Y (no 19del), N501Y, N501Y + D614G, N501Y + L452R + D614G, or N501Y + K417N +E484K + D614G, N501Y + D614G + K417N + L452R +E484K, N501Y + D614G + K417N + L452R + E484Q PsVs This Paper N/A Biological samples COVID 19+ human plasma Stem Cells Lot# 2008421004; 2009418006; 2006417008; 2009418001 COVID 19+ human plasma RayBiotech PS362; PS364 COVID 19+ human plasma This Paper N/A Vaccinated human plasma This Paper N/A Control human plasma Pennsylvania Plasma N/A Chemicals, peptides, and recombinant proteins RBD-Fc This paper N/A RBD-His This paper N/A N501Y-RBD-His Sino Biological Catalog# 40592-V08H82 N501Y-RBD-Fc This paper N/A MPL Sigma Aldrich SAB1406140 D-luciferin GoldBio Catalog # eLUCNA-100; CAS # 103404-75-7 Hoechst 33342 Invitrogen Catalog # H3570 Prolong Glass Invitrogen Catalog # P36980 Zombie Aqua Viability Dye BioLegend Catalog # 423101 Human TruStain FcX BioLegend Catalog # 422301 Critical commercial assays Expi293F expression system kit Thermo Fisher Scientific Catalog # A14635 4-15% Tris-glycine SDS-PAGE gels Bio-Rad Catalog # 4568033 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Catalog # A53225 Luciferase assay kit Promega Catalog # E1500 Lipofectamine 3000 Thermo Fisher Scientific Catalog # L3000001 (Continued on next page) e1 Cell Reports 37, 109838, October 19, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RBD in complex with mouse ACE2 Brooke and Prischi, 2020 https://github.com/fprischi/ Supplementary_ComplexesStructures Experimental models: Cell lines 293 TT cells ATCC CRL-3467 BHK-21 cells ATCC CCL-10 Experimental models: Organisms/strains BALB/c Charles River Strain code: 028 BALB/cAnNCrl C57BL/6 Taconic Model: B6-F C57BL/6NTac Oligonucleotides Primers for generating SARS-CoV2 spike sequence or mutant PsV plasmid, see Table S1 Integrated DNA Technologies N/A Recombinant DNA pCMV3-SARS-CoV-2-S Sino Biological Inc. Beijing, China Catalog # VG40592-UT pFuse-mIgG2a-Fc2 Invivogen pfuse-mg2afc2 pCMV3-SARS-CoV-2-S-N501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19 This paper N/A pCMV3-SARS-CoV-2-S-N501Y-cd19 This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614G This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-E484K This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-L452R-E484Q This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-L452R This paper N/A pfuse-RBD-mIgG2aFc This paper N/A pfuse-RBD-N501Y-mIgG2aFc This paper N/A Software and algorithms CytExpert Beckman Coulter https://www.beckman.com/ flow-cytometry/instruments/cytoflex/ software Gen5 Biotek Instruments https://www.biotek.com/products/ software-robotics-software/gen5microplate-reader-and-imager-software/ Living Image Xenogen https://www.perkinelmer.com/product/ spectrum-200-living-image-v4series1-128113 NIS-Elements Nikon https://www.microscope.healthcare.nikon. Article Title: POLE Mutation Spectra Are Shaped by the Mutant Allele Identity, Its Abundance, and Mismatch Repair Status. Article Snippet: Article Article Title: Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RAD52 Santa Cruz Cat# sc-8350; RRID:AB_2284949 RAD51 Santa Cruz Cat# sc-8349; RRID:AB_2253533 POLD3 Bethyl Cat# A301-244A; RRID:AB_890596 POLD4 Novus Biologicals Cat# H00057804-M01A; RRID:AB_2166594 BLM Bethyl Cat# A300-110A; RRID:AB_2064794 GAPDH Millipore Cat# ABS16; RRID:AB_10806772 PML Abcam Cat# ab96051; RRID:AB_10679887 Biotin Abcam Cat# ab53494; RRID:AB_867860 Chemicals, and Recombinant Proteins T4 polynucleotide Kinase NEB M0201S Proteinase K Thermo Fischer 25530049 Thymidine Sigma T1895-5G CDKi (RO-3306) Selleckchem S7747 .. ATP gamma P32 Perkin Elmer NEG002250uc IPTG Calbiochem 420322 Ni2+-NTA beads QIAGEN 30230 Affi-Gel Blue Gel BioRad 1537301 Click-iT EdU Alexa Fluor 488 Imaging Kit Thermo Fischer C10337 TelC-FITC PNA Bio F1009 Dextran Sulfate sodium Sigma D8906-10G Formamide Sigma 47671-1L-F 20x SSC Thermo Fischer AM9763 Azide-PEG3-Biotin Sigma 762024-10MG phi29 DNA Polymerase NEB M0269L dNTP Set(100 mM) Thermo Fischer 10297018 PureLink Genomic DNA Mini Kit Thermo Fischer K182002 Sequence-Based Reagents siRNA This Study See Table S1 Primers for C circle This Study See Table S2 Oligos for in vitro substrates preparation This study See Table S3 Software and Mutagenesis:Article Title: In vivo characterization of emerging SARS-CoV-2 variant infectivity and human antibody escape potential Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human IgG-PE secondary antibody Invitrogen Catalog # 62-8420; RRID: AB_2533962 HRP-conjugated anti-human IgG, IgM, IgA (H+L) Invitrogen Catalog # A18847; RRID: AB_2535624 Anti-INFAR-1 (MAR1-5A3) Bio X Cell Catalog # BE0241; RRID: AB_2687723 Anti-RBD primary antibody Sino Biological Catalog # 40592-T62 HRP-conjugated goat anti-rabbit IgG secondary antibody Invitrogen Catalog # 31402 RRID: AB_228395 Anti-His secondary antibody BioLegend Catalog # 652502; RRID: AB_2556553 Anti-VSV-G ATCC Catalog # CRL-2700 Bacterial and virus strains rVSV-dG/G* luciferase Kerafast Catalog # EH1020-PM rVSV-dG/G* GFP Kerafast Catalog # EH1019-PM Recombinant adenoviral vectors expressing human ACE2 (AdV-hACE2) University of Iowa Viral Vector Core Ad5CMVhACE2; VVC-McCray-7723 WT (no 19del), WT, D614G, N501Y (no 19del), N501Y, N501Y + D614G, N501Y + L452R + D614G, or N501Y + K417N +E484K + D614G, N501Y + D614G + K417N + L452R +E484K, N501Y + D614G + K417N + L452R + E484Q PsVs This Paper N/A Biological samples COVID 19+ human plasma Stem Cells Lot# 2008421004; 2009418006; 2006417008; 2009418001 COVID 19+ human plasma RayBiotech PS362; PS364 COVID 19+ human plasma This Paper N/A Vaccinated human plasma This Paper N/A Control human plasma Pennsylvania Plasma N/A Chemicals, peptides, and recombinant proteins RBD-Fc This paper N/A RBD-His This paper N/A N501Y-RBD-His Sino Biological Catalog# 40592-V08H82 N501Y-RBD-Fc This paper N/A MPL Sigma Aldrich SAB1406140 D-luciferin GoldBio Catalog # eLUCNA-100; CAS # 103404-75-7 Hoechst 33342 Invitrogen Catalog # H3570 Prolong Glass Invitrogen Catalog # P36980 Zombie Aqua Viability Dye BioLegend Catalog # 423101 Human TruStain FcX BioLegend Catalog # 422301 Critical commercial assays Expi293F expression system kit Thermo Fisher Scientific Catalog # A14635 4-15% Tris-glycine SDS-PAGE gels Bio-Rad Catalog # 4568033 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Catalog # A53225 Luciferase assay kit Promega Catalog # E1500 Lipofectamine 3000 Thermo Fisher Scientific Catalog # L3000001 (Continued on next page) e1 Cell Reports 37, 109838, October 19, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RBD in complex with mouse ACE2 Brooke and Prischi, 2020 https://github.com/fprischi/ Supplementary_ComplexesStructures Experimental models: Cell lines 293 TT cells ATCC CRL-3467 BHK-21 cells ATCC CCL-10 Experimental models: Organisms/strains BALB/c Charles River Strain code: 028 BALB/cAnNCrl C57BL/6 Taconic Model: B6-F C57BL/6NTac Oligonucleotides Primers for generating SARS-CoV2 spike sequence or mutant PsV plasmid, see Table S1 Integrated DNA Technologies N/A Recombinant DNA pCMV3-SARS-CoV-2-S Sino Biological Inc. Beijing, China Catalog # VG40592-UT pFuse-mIgG2a-Fc2 Invivogen pfuse-mg2afc2 pCMV3-SARS-CoV-2-S-N501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19 This paper N/A pCMV3-SARS-CoV-2-S-N501Y-cd19 This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614G This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-E484K This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-L452R-E484Q This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-L452R This paper N/A pfuse-RBD-mIgG2aFc This paper N/A pfuse-RBD-N501Y-mIgG2aFc This paper N/A Software and algorithms CytExpert Beckman Coulter https://www.beckman.com/ flow-cytometry/instruments/cytoflex/ software Gen5 Biotek Instruments https://www.biotek.com/products/ software-robotics-software/gen5microplate-reader-and-imager-software/ Living Image Xenogen https://www.perkinelmer.com/product/ spectrum-200-living-image-v4series1-128113 NIS-Elements Nikon https://www.microscope.healthcare.nikon. Plasmid Preparation:Article Title: In vivo characterization of emerging SARS-CoV-2 variant infectivity and human antibody escape potential Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human IgG-PE secondary antibody Invitrogen Catalog # 62-8420; RRID: AB_2533962 HRP-conjugated anti-human IgG, IgM, IgA (H+L) Invitrogen Catalog # A18847; RRID: AB_2535624 Anti-INFAR-1 (MAR1-5A3) Bio X Cell Catalog # BE0241; RRID: AB_2687723 Anti-RBD primary antibody Sino Biological Catalog # 40592-T62 HRP-conjugated goat anti-rabbit IgG secondary antibody Invitrogen Catalog # 31402 RRID: AB_228395 Anti-His secondary antibody BioLegend Catalog # 652502; RRID: AB_2556553 Anti-VSV-G ATCC Catalog # CRL-2700 Bacterial and virus strains rVSV-dG/G* luciferase Kerafast Catalog # EH1020-PM rVSV-dG/G* GFP Kerafast Catalog # EH1019-PM Recombinant adenoviral vectors expressing human ACE2 (AdV-hACE2) University of Iowa Viral Vector Core Ad5CMVhACE2; VVC-McCray-7723 WT (no 19del), WT, D614G, N501Y (no 19del), N501Y, N501Y + D614G, N501Y + L452R + D614G, or N501Y + K417N +E484K + D614G, N501Y + D614G + K417N + L452R +E484K, N501Y + D614G + K417N + L452R + E484Q PsVs This Paper N/A Biological samples COVID 19+ human plasma Stem Cells Lot# 2008421004; 2009418006; 2006417008; 2009418001 COVID 19+ human plasma RayBiotech PS362; PS364 COVID 19+ human plasma This Paper N/A Vaccinated human plasma This Paper N/A Control human plasma Pennsylvania Plasma N/A Chemicals, peptides, and recombinant proteins RBD-Fc This paper N/A RBD-His This paper N/A N501Y-RBD-His Sino Biological Catalog# 40592-V08H82 N501Y-RBD-Fc This paper N/A MPL Sigma Aldrich SAB1406140 D-luciferin GoldBio Catalog # eLUCNA-100; CAS # 103404-75-7 Hoechst 33342 Invitrogen Catalog # H3570 Prolong Glass Invitrogen Catalog # P36980 Zombie Aqua Viability Dye BioLegend Catalog # 423101 Human TruStain FcX BioLegend Catalog # 422301 Critical commercial assays Expi293F expression system kit Thermo Fisher Scientific Catalog # A14635 4-15% Tris-glycine SDS-PAGE gels Bio-Rad Catalog # 4568033 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Catalog # A53225 Luciferase assay kit Promega Catalog # E1500 Lipofectamine 3000 Thermo Fisher Scientific Catalog # L3000001 (Continued on next page) e1 Cell Reports 37, 109838, October 19, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RBD in complex with mouse ACE2 Brooke and Prischi, 2020 https://github.com/fprischi/ Supplementary_ComplexesStructures Experimental models: Cell lines 293 TT cells ATCC CRL-3467 BHK-21 cells ATCC CCL-10 Experimental models: Organisms/strains BALB/c Charles River Strain code: 028 BALB/cAnNCrl C57BL/6 Taconic Model: B6-F C57BL/6NTac Oligonucleotides Primers for generating SARS-CoV2 spike sequence or mutant PsV plasmid, see Table S1 Integrated DNA Technologies N/A Recombinant DNA pCMV3-SARS-CoV-2-S Sino Biological Inc. Beijing, China Catalog # VG40592-UT pFuse-mIgG2a-Fc2 Invivogen pfuse-mg2afc2 pCMV3-SARS-CoV-2-S-N501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19 This paper N/A pCMV3-SARS-CoV-2-S-N501Y-cd19 This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614G This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-E484K This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-K417N-L452R-E484Q This paper N/A pCMV3-SARS-CoV-2-S-cd19-D614GN501Y-L452R This paper N/A pfuse-RBD-mIgG2aFc This paper N/A pfuse-RBD-N501Y-mIgG2aFc This paper N/A Software and algorithms CytExpert Beckman Coulter https://www.beckman.com/ flow-cytometry/instruments/cytoflex/ software Gen5 Biotek Instruments https://www.biotek.com/products/ software-robotics-software/gen5microplate-reader-and-imager-software/ Living Image Xenogen https://www.perkinelmer.com/product/ spectrum-200-living-image-v4series1-128113 NIS-Elements Nikon https://www.microscope.healthcare.nikon. Inverted Microscopy:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Fluorescence:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Tissue:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Suspension:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Live Cell Imaging:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and other:Article Title: Rational Design of Allosteric and Selective Inhibitors of the Molecular Chaperone TRAP1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Morpholino: MO-TRAP1: GATCGGATCATTTCT GCTGTAG This paper N/A Single guide RNA sequence: mouse TRAP1 #1: CACCGCGCCGAACTCCAGCCAGCGC Masgras et al., 2017b N/A Single guide RNA sequence: mouse TRAP1 #2: CACCGTTTGTGTGGGGCCCCTAAAC Masgras et al., 2017b N/A Single guide RNA sequence: human TRAP1 #1: CACCGAAAGCTTCTTTGTCTCGGCC Masgras et al., 2017b N/A Single guide RNA sequence: human TRAP1 #2: CACCGCAGTTTTTCCAAGGCATCGC Masgras et al., 2017b N/A Recombinant DNA Plasmid: pET151/D-TOPO/TRAP1 Lavery et al., 2014 Laboratory of Dr. David Agard Plasmid: lentiCRISPRv2 Sanjana et al., 2014 Addgene plasmid #52961; RRID: Addgene_52961 Plasmid: pcDNA3 mito-GFP1-9 Genscript N/A Plasmid: pcDNA3-TRAP1-GFP10 modified with the tenth b-strand of sfGFP at the C terminus: EFGGSLEGGGTTMDLPDDHYLSTQTILSK DLNGTDVG Genscript N/A Plasmid: pcDNA3-SDHA-GFP11 modified with the eleventh b-strand of sfGFP at the C terminus: EFSGSGGGSGGGSTSEKRDHMVLLETV TAAGGITDAS Genscript N/A Plasmid: pcDNA3-ATP50-GFP10 modified with the tenth b-strand of sfGFP at the C terminus: EFGGSLEGGGTTMDLPDDHYLSTQT ILSKDLNGTDVG Genscript N/A Software and Algorithms MAESTRO Schrodinger inc. https://www.schrodinger.com Article Title: A Dual Function for Prickle in Regulating Frizzled Stability during Feedback-Dependent Amplification of Planar Polarity Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP, affinity purified Abcam cat#ab6556; RRID: AB_305564 Mouse monoclonal anti-actin AC-40 Sigma-Aldrich cat#A4700; RRID: AB_476730 Mouse monoclonal anti-Fmi #74 Developmental Studies Hybridoma Bank [14] RRID: AB_2619583 Rat anti-Pk, affinity purified David Strutt [49] N/A Rabbit anti-Dsh, affinity purified David Strutt [49] N/A Rabbit anti-Stbm Tanya Wolff [50] N/A Chemicals, Peptides, and Recombinant Proteins 16% paraformaldehyde solution (methanol free) Agar Scientific cat#R1026 Triton X-100 VWR cat#28817.295; CAS: 9002-93-1 Glycerol VWR cat#284546F; CAS: 56-81-5 DABCO Fluka cat#33480; CAS: 280-57-9 Normal Goat Serum Jackson Labs cat#005-000-121 Halocarbon 700 Oil Halocarbon Products CAS: 9002-83-9 Experimental Models: Organisms/Strains fmiE59 Tadashi Uemura [14] FlyBase: FBal0101421 stbm6 Tanya Wolff [51] FlyBase: FBal0062423 dshV26 Norbert Perrimon [52] FlyBase: FBal0003140 dsh1 Bloomington Drosophila Stock Center FlyBase: FBal0003138; RRID: BDSC_5298 pkpk-sple13 David Gubb [53] FlyBase: FBal0060943 dgo380 Suzanne Eaton [25] FlyBase: FBal0141190 shits1 Bloomington Drosophila Stock Center FlyBase: FBal0015610; RRID: BDSC_7068 fz-EGFP David Strutt [5] N/A P[acman]-EGFP-dsh David Strutt [5] N/A pActP>STOP>dsh-ECFP David Strutt [35] N/A pActP>STOP>FLAG-stbm This paper N/A pActP>STOP>FLAG-pk This paper N/A pActP>STOP>FLAG-dgo This paper N/A UAS-Pk attP{VK00031} This paper N/A tub-CFP-Rab5 Suzanne Eaton [54] N/A sqh-Clc::mCherry Thomas Lecuit [55] N/A pUAS-Rab5S43N Bloomington Drosophila Stock Center FlyBase: FBti0150344; RRID: BDSC_42703 hs-FLP Bloomington Drosophila Stock Center FlyBase: FBti0002044; RRID: BDSC_6 FLP22 Bloomington Drosophila Stock Center FlyBase: FBti0000785; RRID: BDSC_8862 Ubx-FLP Bloomington Drosophila Stock Center FlyBase: FBti0150334; RRID: BDSC_42718 Actin-GAL4 Bloomington Drosophila Stock Center FlyBase: FBti0012293; RRID: BDSC_4414 tubulin-Gal80ts Bloomington Drosophila Stock Center FlyBase: FBti0027796; RRID: BDSC_7019 Actin>y+>GAL4 Bloomington Drosophila Stock Center FlyBase: FBti0012290; RRID: BDSC_3953 Ubi-mRFP-nls Bloomington Drosophila Stock Center FlyBase: FBti0129786; RRID: BDSC_30852 Software and Algorithms NIS Elements AR version 4.60 Nikon N/A Western Blot:Article Title: POLE Mutation Spectra Are Shaped by the Mutant Allele Identity, Its Abundance, and Mismatch Repair Status. Article Snippet: Article Variant Assay:Article Title: POLE Mutation Spectra Are Shaped by the Mutant Allele Identity, Its Abundance, and Mismatch Repair Status. Article Snippet: Article CRISPR:Article Title: POLE Mutation Spectra Are Shaped by the Mutant Allele Identity, Its Abundance, and Mismatch Repair Status. Article Snippet: Article Imaging:Article Title: Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RAD52 Santa Cruz Cat# sc-8350; RRID:AB_2284949 RAD51 Santa Cruz Cat# sc-8349; RRID:AB_2253533 POLD3 Bethyl Cat# A301-244A; RRID:AB_890596 POLD4 Novus Biologicals Cat# H00057804-M01A; RRID:AB_2166594 BLM Bethyl Cat# A300-110A; RRID:AB_2064794 GAPDH Millipore Cat# ABS16; RRID:AB_10806772 PML Abcam Cat# ab96051; RRID:AB_10679887 Biotin Abcam Cat# ab53494; RRID:AB_867860 Chemicals, and Recombinant Proteins T4 polynucleotide Kinase NEB M0201S Proteinase K Thermo Fischer 25530049 Thymidine Sigma T1895-5G CDKi (RO-3306) Selleckchem S7747 .. ATP gamma P32 Perkin Elmer NEG002250uc IPTG Calbiochem 420322 Ni2+-NTA beads QIAGEN 30230 Affi-Gel Blue Gel BioRad 1537301 Click-iT EdU Alexa Fluor 488 Imaging Kit Thermo Fischer C10337 TelC-FITC PNA Bio F1009 Dextran Sulfate sodium Sigma D8906-10G Formamide Sigma 47671-1L-F 20x SSC Thermo Fischer AM9763 Azide-PEG3-Biotin Sigma 762024-10MG phi29 DNA Polymerase NEB M0269L dNTP Set(100 mM) Thermo Fischer 10297018 PureLink Genomic DNA Mini Kit Thermo Fischer K182002 Sequence-Based Reagents siRNA This Study See Table S1 Primers for C circle This Study See Table S2 Oligos for in vitro substrates preparation This study See Table S3 Software and In Vitro:Article Title: Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RAD52 Santa Cruz Cat# sc-8350; RRID:AB_2284949 RAD51 Santa Cruz Cat# sc-8349; RRID:AB_2253533 POLD3 Bethyl Cat# A301-244A; RRID:AB_890596 POLD4 Novus Biologicals Cat# H00057804-M01A; RRID:AB_2166594 BLM Bethyl Cat# A300-110A; RRID:AB_2064794 GAPDH Millipore Cat# ABS16; RRID:AB_10806772 PML Abcam Cat# ab96051; RRID:AB_10679887 Biotin Abcam Cat# ab53494; RRID:AB_867860 Chemicals, and Recombinant Proteins T4 polynucleotide Kinase NEB M0201S Proteinase K Thermo Fischer 25530049 Thymidine Sigma T1895-5G CDKi (RO-3306) Selleckchem S7747 .. ATP gamma P32 Perkin Elmer NEG002250uc IPTG Calbiochem 420322 Ni2+-NTA beads QIAGEN 30230 Affi-Gel Blue Gel BioRad 1537301 Click-iT EdU Alexa Fluor 488 Imaging Kit Thermo Fischer C10337 TelC-FITC PNA Bio F1009 Dextran Sulfate sodium Sigma D8906-10G Formamide Sigma 47671-1L-F 20x SSC Thermo Fischer AM9763 Azide-PEG3-Biotin Sigma 762024-10MG phi29 DNA Polymerase NEB M0269L dNTP Set(100 mM) Thermo Fischer 10297018 PureLink Genomic DNA Mini Kit Thermo Fischer K182002 Sequence-Based Reagents siRNA This Study See Table S1 Primers for C circle This Study See Table S2 Oligos for in vitro substrates preparation This study See Table S3 Software and |